🌐 English / Беларуская / Українська / Русский

The release is based on RefSeq release 231.
The metadata consists of the following files:
The fasta file is compressed with gzip, and the metadata file is a zip archive. To uncompress them, Linux and Mac OS users may use gzip and zip programs, they should be built-in. For Windows users, the free and open-source (de)compression program 7-Zip is available.
You can find all releases in the RiboGrove release archive.
No important differences from the previous release.
You can find notes to all RiboGrove releases on the release notes page.
| Bacteria | Archaea | Total | |
|---|---|---|---|
| Number of gene sequences | 282,687 | 1,094 | 283,781 |
| Number of unique gene sequences | 67,238 | 771 | 68,009 |
| Number of species | 13,019 | 497 | 13,516 |
| Number of genomes | 51,331 | 627 | 51,958 |
| Number of genomes of category 1 | 34,299 | 257 | 34,556 |
| Number of genomes of category 2 | 16,760 | 370 | 17,130 |
| Number of genomes of category 3 | 272 | 0 | 272 |
| Bacteria | Archaea | |
|---|---|---|
| Minimum (bp) | 1,401.00 | 1,439.00 |
| 25th percentile (bp) * | 1,517.00 | 1,471.00 |
| Median (bp) * | 1,529.00 | 1,473.50 |
| 75th percentile (bp) * | 1,542.00 | 1,483.00 |
| Average (bp) * | 1,527.10 | 1,491.28 |
| Mode (bp) * | 1,537.00 | 1,472.00 |
| Maximum (bp) | 2,438.00 | 3,604.00 |
| Standard deviation (bp) * | 25.09 | 120.93 |
* Metrics marked with an asterisk were calculated with preliminary normalization, i.e. median within-species gene length was used for the summary.
| Copy number * | Bacteria | Archaea | ||
|---|---|---|---|---|
| Number of species | Percent of species (%) | Number of species | Percent of species (%) | |
| 1 | 1,622 | 12.46 | 248 | 49.90 |
| 2 | 2,212 | 16.99 | 151 | 30.38 |
| 3 | 1,774 | 13.63 | 75 | 15.09 |
| 4 | 1,631 | 12.53 | 17 | 3.42 |
| 5 | 1,017 | 7.81 | 6 | 1.21 |
| 6 | 1,730 | 13.29 | 0 | 0.00 |
| 7 | 1,186 | 9.11 | 0 | 0.00 |
| 8 | 661 | 5.08 | 0 | 0.00 |
| 9 | 341 | 2.62 | 0 | 0.00 |
| 10 | 317 | 2.43 | 0 | 0.00 |
| 11 | 161 | 1.24 | 0 | 0.00 |
| 12 | 145 | 1.11 | 0 | 0.00 |
| 13 | 60 | 0.46 | 0 | 0.00 |
| 14 | 88 | 0.68 | 0 | 0.00 |
| 15 | 26 | 0.20 | 0 | 0.00 |
| 16 | 12 | 0.09 | 0 | 0.00 |
| 17 | 13 | 0.10 | 0 | 0.00 |
| 18 | 6 | 0.05 | 0 | 0.00 |
| 19 | 3 | 0.02 | 0 | 0.00 |
| 20 | 8 | 0.06 | 0 | 0.00 |
| 21 | 1 | 0.01 | 0 | 0.00 |
| 22 | 1 | 0.01 | 0 | 0.00 |
| 24 | 1 | 0.01 | 0 | 0.00 |
| 25 | 1 | 0.01 | 0 | 0.00 |
| 27 | 1 | 0.01 | 0 | 0.00 |
| 37 | 1 | 0.01 | 0 | 0.00 |
* These are median within-species copy numbers.
| Organism | Gene length (bp) | RiboGrove Sequence ID(s) | Assembly accession |
|---|---|---|---|
| Bacteria | |||
| Thermus thermophilus strain AA2-2 | 2,438 | GCF_019974355.1:NZ_AP024929.1:249100-251537:minus | GCF_019974355.1 |
| Ca. Annandia pinicola strain Ad13-065 | 1,887 | GCF_020541245.1:NZ_CP045876.1:290071-291957:minus | GCF_020541245.1 |
| Thermoanaerobacter ethanolicus strain JW 200 |
1,812 | GCF_003722315.1:NZ_CP033580.1:456062-457873:plus | GCF_003722315.1 |
| Nitrosophilus labii strain HRV44 | 1,806 | GCF_014466985.1:NZ_AP022826.1:1258017-1259822:minus GCF_014466985.1:NZ_AP022826.1:1532588-1534393:minus GCF_014466985.1:NZ_AP022826.1:1939914-1941719:minus |
GCF_014466985.1 |
| Agarivorans sp. QJM3NY_29 | 1,803 | GCF_050870835.1:NZ_CP194036.1:2383763-2385565:plus | GCF_050870835.1 |
| Agarivorans sp. Z349TD_7 | 1,803 | GCF_050870845.1:NZ_CP194040.1:2364672-2366474:plus | GCF_050870845.1 |
| Agarivorans sp. QJM3NY_30 | 1,803 | GCF_050870855.1:NZ_CP194038.1:532120-533922:plus | GCF_050870855.1 |
| Sporomusa rhizae strain DSM 16652 | 1,802 | GCF_041428845.1:NZ_CP156925.1:3123180-3124981:minus | GCF_041428845.1 |
| Gelria sp. Kuro-4 | 1,788 | GCF_019668485.1:NZ_AP024619.1:2016182-2017969:minus | GCF_019668485.1 |
| Helicobacter mastomyrinus strain Hm-17 |
1,785 | GCF_039555295.1:NZ_CP145316.1:765140-766924:minus | GCF_039555295.1 |
| Archaea | |||
| Organism | Gene length (bp) | RiboGrove Sequence ID(s) | Assembly accession |
|---|---|---|---|
| Pyrobaculum ferrireducens strain 1860 | 3,604 | GCF_000234805.1:NC_016645.1:127214-130817:plus | GCF_000234805.1 |
| Pyrobaculum aerophilum strain IM2 | 2,213 | GCF_000007225.1:NC_003364.1:1089640-1091852:plus | GCF_000007225.1 |
| Pyrobaculum arsenaticum strain DSM 13514 | 2,212 | GCF_000016385.1:NC_009376.1:623323-625534:minus | GCF_000016385.1 |
| Aeropyrum pernix strain K1 | 2,202 | GCF_000011125.1:NC_000854.2:1218712-1220913:minus | GCF_000011125.1 |
| Pyrobaculum neutrophilum strain V24Sta | 2,197 | GCF_000019805.1:NC_010525.1:690419-692615:plus | GCF_000019805.1 |
| Ca. Mancarchaeum acidiphilum strain Mia14 | 2,008 | GCF_002214165.1:NZ_CP019964.1:751297-753304:minus | GCF_002214165.1 |
| Ca. Micrarchaeum sp. A_DKE | 2,003 | GCF_016806735.1:NZ_CP060530.1:203642-205644:minus | GCF_016806735.1 |
| Caldivirga maquilingensis strain IC-167 | 1,679 | GCF_000018305.1:NC_009954.1:129150-130828:minus | GCF_000018305.1 |
| Aeropyrum camini strain SY1 | 1,650 | GCF_000591035.1:NC_022521.1:1165168-1166817:minus | GCF_000591035.1 |
| Pyrolobus fumarii strain 1A | 1,576 | GCF_000223395.1:NC_015931.1:84671-86246:minus | GCF_000223395.1 |
| Organism | Gene length (bp) | RiboGrove Sequence ID(s) | Assembly accession |
|---|---|---|---|
| Bacteria | |||
| Anabaena sp. YBS01 | 1,401 | GCF_009498015.1:NZ_CP034058.1:6920299-6921699:minus | GCF_009498015.1 |
| Clostridioides difficile strain TW11 | 1,426 | GCF_009362915.1:NZ_CP045224.1:4068440-4069865:minus | GCF_009362915.1 |
| Roseicitreum antarcticum strain ZS2-28 |
1,447 | GCF_014681765.1:NZ_CP061498.1:3436150-3437596:plus | GCF_014681765.1 |
| Hirschia baltica strain ATCC 49814 | 1,448 | GCF_000023785.1:NC_012982.1:2336679-2338126:minus | GCF_000023785.1 |
| Mameliella alba strain KU6B | 1,449 | GCF_011405015.1:NZ_AP022337.1:1420943-1422391:plus GCF_011405015.1:NZ_AP022337.1:3191212-3192660:minus GCF_011405015.1:NZ_AP022337.1:267140-268588:plus |
GCF_011405015.1 |
| Sagittula stellata strain E-37 | 1,449 | GCF_039724765.1:NZ_CP155729.1:664616-666064:plus GCF_039724765.1:NZ_CP155729.1:1804792-1806240:plus |
GCF_039724765.1 |
| Mameliella sp. | 1,449 | GCF_965277915.1:NZ_OZ255849.1:1028793-1030241:plus GCF_965277915.1:NZ_OZ255849.1:2596915-2598363:minus GCF_965277915.1:NZ_OZ255849.1:4859504-4860952:plus |
GCF_965277915.1 |
| Sagittula sp. MA-2 | 1,449 | GCF_030126985.1:NZ_CP126145.1:439-1887:plus GCF_030126985.1:NZ_CP126145.1:2907211-2908659:minus |
GCF_030126985.1 |
| Mameliella sp. | 1,449 | GCF_965249415.1:NZ_OZ252233.1:702863-704311:plus GCF_965249415.1:NZ_OZ252233.1:1895495-1896943:plus GCF_965249415.1:NZ_OZ252233.1:3463560-3465008:minus |
GCF_965249415.1 |
| Mameliella sp. | 1,449 | GCF_965212485.1:NZ_OZ243118.1:780420-781868:minus GCF_965212485.1:NZ_OZ243118.1:3042962-3044410:plus GCF_965212485.1:NZ_OZ243118.1:4611080-4612528:minus |
GCF_965212485.1 |
| Organism | Gene length (bp) | RiboGrove Sequence ID(s) | Assembly accession |
|---|---|---|---|
| Sagittula sp. P11 | 1,449 | GCF_002814095.1:NZ_CP021913.1:3597920-3599368:plus GCF_002814095.1:NZ_CP021913.1:2386837-2388285:plus |
GCF_002814095.1 |
| Archaea | |||
| Organism | Gene length (bp) | RiboGrove Sequence ID(s) | Assembly accession |
|---|---|---|---|
| Ignicoccus hospitalis strain KIN4/I | 1,439 | GCF_000017945.1:NC_009776.1:728362-729800:plus | GCF_000017945.1 |
| Methanocaldococcus lauensis strain SG7 | 1,457 | GCF_902827225.1:NZ_LR792632.1:542755-544211:plus | GCF_902827225.1 |
| Halorubrum sp. BOL3-1 | 1,463 | GCF_004114375.1:NZ_CP034692.1:397753-399215:minus | GCF_004114375.1 |
| Salinirubellus litoreus strain SYNS196 | 1,466 | GCF_037335815.1:NZ_CP147841.1:597195-598660:minus | GCF_037335815.1 |
| Natronomonas marina strain ZY43 | 1,466 | GCF_024298905.1:NZ_CP101154.1:18680-20145:plus | GCF_024298905.1 |
| Natronomonas gomsonensis strain KCTC 4088 | 1,466 | GCF_024300825.1:NZ_CP101323.1:2500564-2502029:plus | GCF_024300825.1 |
| Salinirubellus salinus strain ZS-35-S2 | 1,466 | GCF_025231485.1:NZ_CP104003.1:3070232-3071697:plus | GCF_025231485.1 |
| Methanospirillum hungatei strain JF-1 | 1,466 | GCF_000013445.1:NC_007796.1:39814-41279:plus GCF_000013445.1:NC_007796.1:1301079-1302544:minus GCF_000013445.1:NC_007796.1:3501525-3502990:minus GCF_000013445.1:NC_007796.1:3507609-3509074:minus |
GCF_000013445.1 |
| Methanospirillum purgamenti strain J.3.6.1-F.2.7.3 |
1,466 | GCF_018502485.1:NZ_CP075546.1:133354-134819:plus GCF_018502485.1:NZ_CP075546.1:825954-827419:plus GCF_018502485.1:NZ_CP075546.1:872641-874106:plus GCF_018502485.1:NZ_CP075546.1:1727419-1728884:plus |
GCF_018502485.1 |
| Ca. Methanomethylophilus alvi strain Mx1201 | 1,466 | GCF_000300255.2:NC_020913.1:283607-285072:plus | GCF_000300255.2 |
| Organism | Gene length (bp) | RiboGrove Sequence ID(s) | Assembly accession |
|---|---|---|---|
| Natronomonas halophila strain C90 | 1,466 | GCF_013391085.1:NZ_CP058334.1:1530622-1532087:minus | GCF_013391085.1 |
| Methanomethylophilus alvi strain Mx-05 | 1,466 | GCF_003711245.1:NZ_CP017686.1:283608-285073:plus | GCF_003711245.1 |
| Methanospirillum purgamenti strain GP1 | 1,466 | GCF_019263745.1:NZ_CP077107.1:4649-6114:plus GCF_019263745.1:NZ_CP077107.1:1359562-1361027:minus GCF_019263745.1:NZ_CP077107.1:1365502-1366967:minus GCF_019263745.1:NZ_CP077107.1:1986020-1987485:minus |
GCF_019263745.1 |
| Methanospirillum stamsii strain Pt1 | 1,466 | GCF_046244385.1:NZ_CP176366.1:1311724-1313189:plus GCF_046244385.1:NZ_CP176366.1:2035802-2037267:plus GCF_046244385.1:NZ_CP176366.1:2042927-2044392:plus GCF_046244385.1:NZ_CP176366.1:3625347-3626812:minus |
GCF_046244385.1 |
| Methanomethylophilus alvi strain MGYG-HGUT-02456 | 1,466 | GCF_902387285.1:NZ_LR699000.1:283607-285072:plus | GCF_902387285.1 |
| Organism | Copy number | Assembly accession | |
|---|---|---|---|
| Bacteria | |||
| Tumebacillus avium strain AR23208 | 37 | GCF_002162355.1 | |
| Tumebacillus algifaecis strain THMBR28 | 27 | GCF_002243515.1 | |
| Photobacterium piscicola strain WVL24019 | 25 | GCF_046058925.1 | |
| Photobacterium phosphoreum strain MIP2473 | 24 | GCF_949787665.1 | |
| Mesobacillus maritimus strain ADH-29 | 22 | GCF_044803185.1 | |
| Peribacillus asahii strain KF4 | 21 | GCF_023823975.1 | |
| Aneurinibacillus sp. Ricciae_BoGa-3 | 21 | GCF_028421645.1 | |
| Photobacterium damselae strain Phdp Wu-1 | 21 | GCF_003130755.1 | |
| Photobacterium damselae strain Pdd1411 | 21 | GCF_030168855.1 | |
| Photobacterium leiognathi strain Sr3.10 | 21 | GCF_048537505.1 | |
| Organism | Copy number | Assembly accession |
|---|---|---|
| Photobacterium leiognathi strain Sr3.21 | 21 | GCF_048537525.1 |
| Organism | Copy number | Assembly accession | |
|---|---|---|---|
| Archaea | |||
| Natronorubrum bangense strain JCM 10635 | 5 | GCF_004799645.1 | |
| Methanolobus sp. ZRKC3 | 5 | GCF_045291275.1 | |
| Methanococcoides orientis strain LMO-1 | 5 | GCF_021184045.1 | |
| Natrinema sp. SYSU A 869 | 5 | GCF_019879105.1 | |
| Natronorubrum aibiense strain 7-3 | 5 | GCF_009392895.1 | |
| Methanoplanus endosymbiosus strain DSM 3599 | 5 | GCF_024662215.1 | |
| Methanococcus vannielii strain SB | 4 | GCF_000017165.1 | |
| Methanospirillum purgamenti strain J.3.6.1-F.2.7.3 |
4 | GCF_018502485.1 | |
| Methanolobus mangrovi strain FTZ2 | 4 | GCF_031312535.1 | |
| Halomicrobium salinisoli strain TH30 | 4 | GCF_020405245.1 | |
| Organism | Copy number | Assembly accession |
|---|---|---|
| Methanolobus sediminis strain FTZ6 | 4 | GCF_031312595.1 |
| Haloarcula marismortui strain ATCC 33800 | 4 | GCF_018200015.1 |
| Methanolobus sp. WCC4 | 4 | GCF_038022665.1 |
| Haloterrigena salifodinae strain BOL5-1 | 4 | GCF_016906025.1 |
| Methanosphaera stadtmanae strain DSM 3091 | 4 | GCF_000012545.1 |
| Methanospirillum lacunae strain Ki8-1 | 4 | GCF_046195335.1 |
| Halomicrobium urmianum strain IBRC-M: 10911 | 4 | GCF_020217425.1 |
| Halomicrobium salinisoli strain LT50 | 4 | GCF_020405185.1 |
| Methanochimaera problematica strain FWC-SCC4 | 4 | GCF_032878975.1 |
| Methanogenium sp. S4BF | 4 | GCF_029633965.1 |
| Natrinema thermotolerans strain A29 | 4 | GCF_031165565.1 |
| Methanospirillum hungatei strain JF-1 | 4 | GCF_000013445.1 |
| Methanospirillum purgamenti strain GP1 | 4 | GCF_019263745.1 |
| Methanospirillum stamsii strain Pt1 | 4 | GCF_046244385.1 |
| Methanosphaera stadtmanae strain MGYG-HGUT-02164 | 4 | GCF_902384015.1 |
| Methanogenium organophilum strain DSM 3596 | 4 | GCF_026684035.1 |
| Natronococcus occultus strain SP4 | 4 | GCF_000328685.1 |
| Organism | Sum of entropy * (bits) | Mean entropy * (bits) | Number of variable positions | Gene copy number | Assembly accession |
|---|---|---|---|---|---|
| Bacteria | |||||
| Clostridium perfringens strain A SNU21005 | 780.95 | 0.41 | 1,171 | 9 | GCF_047150065.1 |
| Escherichia coli strain P276M | 433.81 | 0.26 | 569 | 6 | GCF_009762385.1 |
| Listeria monocytogenes strain 10-092876-1155 LM6 |
357.10 | 0.20 | 370 | 3 | GCF_001999045.1 |
| Klebsiella pneumoniae strain GZ-1 | 304.27 | 0.18 | 464 | 8 | GCF_014854815.1 |
| Streptococcus infantis strain SO | 291.50 | 0.18 | 308 | 3 | GCF_021497965.1 |
| Synechococcus sp. NB0720_010 | 243.35 | 0.16 | 265 | 3 | GCF_023078835.1 |
| Streptomyces griseorubiginosus strain NBC_00586 |
231.55 | 0.15 | 342 | 6 | GCF_036345135.1 |
| Caminibacter mediatlanticus strain TB-2 | 228.78 | 0.15 | 282 | 4 | GCF_005843985.1 |
| Xanthomonas oryzae strain YNCX | 227.74 | 0.15 | 248 | 3 | GCF_024499285.1 |
| Sporomusa termitida strain DSM 4440 | 226.25 | 0.13 | 247 | 12 | GCF_007641255.1 |
| Archaea | |||||
| Halomicrobium sp. ZPS1 ** | 137.00 | 0.09 | 137 | 2 | GCF_009217585.1 |
| Halomicrobium urmianum strain IBRC-M: 10911 |
131.55 | 0.09 | 146 | 4 | GCF_020217425.1 |
| Halapricum desulfuricans strain HSR12-2 | 128.00 | 0.09 | 128 | 2 | GCF_017094525.1 |
| Halomicrobium salinisoli strain TH30 | 127.74 | 0.09 | 145 | 4 | GCF_020405245.1 |
| Halapricum desulfuricans strain HSR-Bgl | 127.00 | 0.09 | 127 | 2 | GCF_017094445.1 |
| Halomicrobium mukohataei strain JP60 | 125.81 | 0.09 | 137 | 3 | GCF_004803735.1 |
| Halomicrobium sp. HM KBTZ05 | 124.38 | 0.08 | 134 | 3 | GCF_041530035.1 |
| Halomicrobium salinisoli strain LT50 | 123.31 | 0.08 | 140 | 4 | GCF_020405185.1 |
| Halapricum desulfuricans strain HSR-Est | 111.00 | 0.08 | 111 | 2 | GCF_017094465.1 |
| Halapricum desulfuricans strain HSR12-1 | 109.00 | 0.07 | 109 | 2 | GCF_017094505.1 |
* Entropy is Shannon entropy calculated for each column of the multiple sequence alignment (MSA) of all full-length 16S rRNA genes of a genome. Entropy is then summed up (column “Sum of entropy”) and averaged (column “Mean entropy”).
** Halomicrobium sp. ZPS1 is a quite remarkable case. This genome harbours two 16S rRNA genes, therefore entropy is equal to the number of mismatching nucleotides between sequences of the genes. Respectively, percent of identity between these two gene sequences is 90.70%! This is remarkable because the usual (however arbitrary) genus demarcation threshold of percent of identity is 95%.
* Coverage of a primer pair is the percent of genomes having at least one 16S rRNA gene which can be amplified by PCR using this primer pair. For details, see our paper about RiboGrove.
In the tables below, you can find coverage of primer pairs that are being commonly used to amplify bacterial and archaeal genes (“bacterial” and “archaeal” primers).
You can find a more detailed table in the file primer_pair_genomic_coverage.tsv in the metadata. That table contains coverage not just for phyla, but also for each class, order, family, genus, and species. Moreover, that table contains coverage values for additional primer pairs, namely 1115F-1492R, 349f-519r, 1106F-Ar1378R, 1106F-SSU1492Rngs, SSU1ArF-SSU468R, SSU1ArF-SSU520R. In the tables below, they are omitted for brevity.
| Phylum | Number of genomes |
Full gene | V1–V2 | V1–V3 | V3–V4 | V3–V5 | V4 | V4–V5 | V4–V6 | V5–V6 | V5–V7 | V6–V7 | V6–V8 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 27F– 1492R (%) |
27F– 338R (%) |
27F– 534R (%) |
341F– 785R (%) |
341F– 944R (%) |
515F– 806R (%) |
515F– 944R (%) |
515F– 1100R (%) |
784F– 1100R (%) |
784F– 1193R (%) |
939F– 1193R (%) |
939F– 1378R (%) |
||
| Pseudomonadota | 28,071 | 99.49 | 99.30 | 99.47 | 99.82 | 84.07 | 99.89 | 84.25 | 88.57 | 88.23 | 93.63 | 92.74 | 96.44 |
| Bacillota | 11,868 | 99.84 | 99.76 | 99.81 | 99.94 | 95.29 | 99.97 | 95.16 | 99.49 | 98.13 | 97.56 | 98.69 | 99.39 |
| Actinomycetota | 5,285 | 99.91 | 99.17 | 99.74 | 94.89 | 65.45 | 94.70 | 65.20 | 97.07 | 99.77 | 99.85 | 99.85 | 97.05 |
| Bacteroidota | 1,768 | 96.61 | 96.27 | 96.66 | 99.89 | 64.37 | 99.38 | 63.97 | 38.18 | 38.29 | 92.25 | 91.97 | 95.64 |
| Campylobacterota | 1,325 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 99.92 | 99.92 | 99.92 | 99.47 | 99.47 | 99.70 | 99.55 |
| Mycoplasmatota | 838 | 90.21 | 84.37 | 73.63 | 99.05 | 92.00 | 99.16 | 92.36 | 72.32 | 48.57 | 43.68 | 78.76 | 0.72 |
| Spirochaetota | 424 | 56.13 | 56.37 | 56.60 | 93.63 | 99.76 | 93.63 | 99.76 | 99.76 | 73.35 | 73.35 | 89.62 | 44.58 |
| Cyanobacteriota | 383 | 99.74 | 99.74 | 99.74 | 100.00 | 3.92 | 100.00 | 3.92 | 100.00 | 1.31 | 1.31 | 100.00 | 99.74 |
| Fusobacteriota | 244 | 100.00 | 98.77 | 99.59 | 99.59 | 99.59 | 99.59 | 99.59 | 99.59 | 99.59 | 99.59 | 100.00 | 0.00 |
| Chlamydiota | 241 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 100.00 | 94.61 |
| Thermodesulfobacteriota | 156 | 100.00 | 99.36 | 100.00 | 100.00 | 39.10 | 100.00 | 39.10 | 100.00 | 95.51 | 91.67 | 96.15 | 99.36 |
| Verrucomicrobiota | 140 | 99.29 | 0.00 | 99.29 | 100.00 | 12.86 | 100.00 | 12.86 | 100.00 | 1.43 | 1.43 | 98.57 | 98.57 |
| Deinococcota | 98 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 52.04 | 100.00 |
| Planctomycetota | 77 | 100.00 | 28.57 | 100.00 | 100.00 | 62.34 | 100.00 | 62.34 | 0.00 | 0.00 | 0.00 | 2.60 | 0.00 |
| Myxococcota | 74 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Chloroflexota | 52 | 100.00 | 92.31 | 100.00 | 42.31 | 0.00 | 94.23 | 0.00 | 90.38 | 11.54 | 11.54 | 94.23 | 26.92 |
| Thermotogota | 50 | 100.00 | 98.00 | 100.00 | 100.00 | 8.00 | 100.00 | 8.00 | 100.00 | 0.00 | 0.00 | 52.00 | 98.00 |
| Acidobacteriota | 43 | 97.67 | 97.67 | 97.67 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 72.09 | 58.14 | 86.05 | 100.00 |
| Bdellovibrionota | 43 | 100.00 | 100.00 | 100.00 | 100.00 | 76.74 | 100.00 | 76.74 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Aquificota | 18 | 100.00 | 16.67 | 100.00 | 100.00 | 16.67 | 100.00 | 16.67 | 100.00 | 0.00 | 0.00 | 0.00 | 16.67 |
| Rhodothermota | 16 | 43.75 | 43.75 | 43.75 | 100.00 | 100.00 | 100.00 | 100.00 | 81.25 | 81.25 | 100.00 | 100.00 | 100.00 |
| Chlorobiota | 15 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 93.33 | 86.67 | 6.67 |
| Nitrospirota | 15 | 100.00 | 100.00 | 100.00 | 100.00 | 73.33 | 100.00 | 73.33 | 100.00 | 100.00 | 73.33 | 73.33 | 100.00 |
| Ca. Saccharimonadota | 13 | 100.00 | 100.00 | 100.00 | 100.00 | 7.69 | 7.69 | 7.69 | 7.69 | 0.00 | 0.00 | 100.00 | 100.00 |
| Gemmatimonadota | 13 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Synergistota | 10 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Elusimicrobiota | 6 | 100.00 | 66.67 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 100.00 | 50.00 | 50.00 | 100.00 | 100.00 |
| Deferribacterota | 6 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Atribacterota | 4 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Ignavibacteriota | 3 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Balneolota | 3 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Thermodesulfobiota | 2 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 |
| Thermomicrobiota | 2 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 100.00 | 0.00 | 0.00 | 50.00 | 50.00 |
| Armatimonadota | 2 | 100.00 | 50.00 | 100.00 | 50.00 | 50.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Chrysiogenota | 2 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Dictyoglomota | 2 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 100.00 | 0.00 | 0.00 | 100.00 | 0.00 |
| Fibrobacterota | 2 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Kiritimatiellota | 2 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Ca. Fervidibacterota | 1 | 100.00 | 0.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Ca. Cloacimonadota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Ca. Bipolaricaulota | 1 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Ca. Absconditibacteriota | 1 | 100.00 | 0.00 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 |
| Calditrichota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Caldisericota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 100.00 |
| Ca. Omnitrophota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Coprothermobacterota | 1 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 |
| Vulcanimicrobiota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Thermosulfidibacterota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Nitrospinota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Minisyncoccota | 1 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Lentisphaerota | 1 | 100.00 | 0.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 |
| Fidelibacterota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 100.00 | 0.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Phylum | Number of genomes |
Full gene | V1–V2 | V1–V3 | V1–V3 | V3–V4 | V3–V4 | V3–V4 | V3–V5 | V3–V5 | V4 | V4–V5 | V5–V7 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SSU1ArF– SSU1492Rngs (%) |
SSU1ArF– SSU280ArR (%) |
SSU1ArF– SSU470R (%) |
SSU1ArF– A519R (%) |
349f– SSU666ArR (%) |
340f– SSU666ArR (%) |
340f– 806rB (%) |
349f– SSU1000ArR (%) |
340f– SSU1000ArR (%) |
515fB– 806rB (%) |
Parch519f– Arch915r (%) |
A751F– UA1204R (%) |
||
| Methanobacteriota | 459 | 88.89 | 86.27 | 89.11 | 88.89 | 51.20 | 50.11 | 100.00 | 99.35 | 100.00 | 100.00 | 99.56 | 89.54 |
| Thermoproteota | 110 | 96.36 | 98.18 | 100.00 | 100.00 | 72.73 | 98.18 | 100.00 | 69.09 | 93.64 | 100.00 | 99.09 | 98.18 |
| Nitrososphaerota | 31 | 96.77 | 96.77 | 96.77 | 96.77 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Thermoplasmatota | 19 | 84.21 | 68.42 | 100.00 | 100.00 | 42.11 | 42.11 | 100.00 | 63.16 | 84.21 | 100.00 | 100.00 | 52.63 |
| Ca. Nanohalarchaeota | 4 | 0.00 | 25.00 | 0.00 | 100.00 | 0.00 | 0.00 | 100.00 | 50.00 | 100.00 | 100.00 | 100.00 | 0.00 |
| Ca. Micrarchaeota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 |
| Nanobdellota | 1 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 |
| Promethearchaeota | 1 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 | 0.00 | 0.00 | 100.00 | 100.00 | 100.00 |
| Phylum | Number of genomes |
Full gene | V1–V2 | V1–V3 | V1–V3 | V3–V4 | V3–V4 | V3–V4 | V3–V5 | V3–V5 | V4 | V4–V5 | V5–V7 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SSU1ArF– SSU1492Rngs (%) |
SSU1ArF– SSU280ArR (%) |
SSU1ArF– SSU470R (%) |
SSU1ArF– A519R (%) |
349f– SSU666ArR (%) |
340f– SSU666ArR (%) |
340f– 806rB (%) |
349f– SSU1000ArR (%) |
340f– SSU1000ArR (%) |
515fB– 806rB (%) |
Parch519f– Arch915r (%) |
A751F– UA1204R (%) |
||
| Pseudomonadota | 28,071 | 1.20 | 0.02 | 0.52 | 0.56 | 0.00 | 0.00 | 0.09 | 0.00 | 0.00 | 99.89 | 27.75 | 0.00 |
| Bacillota | 11,868 | 2.47 | 0.05 | 0.13 | 1.42 | 0.02 | 0.00 | 0.06 | 0.01 | 0.00 | 99.97 | 98.44 | 0.00 |
| Actinomycetota | 5,285 | 0.91 | 0.23 | 0.72 | 1.17 | 0.00 | 0.00 | 0.04 | 0.00 | 0.00 | 94.70 | 87.81 | 0.00 |
| Bacteroidota | 1,768 | 1.87 | 0.00 | 1.81 | 1.92 | 0.00 | 0.00 | 0.17 | 0.00 | 0.00 | 99.38 | 99.26 | 0.00 |
| Campylobacterota | 1,325 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 99.92 | 0.15 | 0.00 |
| Mycoplasmatota | 838 | 1.79 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 99.16 | 80.07 | 0.00 |
| Spirochaetota | 424 | 0.47 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 93.63 | 93.40 | 0.00 |
| Cyanobacteriota | 383 | 3.13 | 0.00 | 0.26 | 0.26 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Fusobacteriota | 244 | 0.41 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 99.59 | 99.59 | 0.00 |
| Chlamydiota | 241 | 1.66 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Thermodesulfobacteriota | 156 | 5.77 | 0.64 | 1.28 | 1.28 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 70.51 | 0.00 |
| Verrucomicrobiota | 140 | 5.71 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 10.00 | 0.71 |
| Deinococcota | 98 | 38.78 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 96.94 | 0.00 |
| Planctomycetota | 77 | 1.30 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 81.82 | 0.00 |
| Myxococcota | 74 | 12.16 | 6.76 | 5.41 | 5.41 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Chloroflexota | 52 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 94.23 | 100.00 | 0.00 |
| Thermotogota | 50 | 38.00 | 0.00 | 28.00 | 28.00 | 0.00 | 0.00 | 6.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Acidobacteriota | 43 | 11.63 | 0.00 | 0.00 | 6.98 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Bdellovibrionota | 43 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 4.65 | 0.00 | 100.00 | 25.58 | 0.00 |
| Aquificota | 18 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 83.33 | 44.44 |
| Rhodothermota | 16 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Chlorobiota | 15 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Nitrospirota | 15 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Ca. Saccharimonadota | 13 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 7.69 | 7.69 | 0.00 |
| Gemmatimonadota | 13 | 0.00 | 7.69 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Synergistota | 10 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Elusimicrobiota | 6 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Deferribacterota | 6 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Atribacterota | 4 | 50.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Ignavibacteriota | 3 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Balneolota | 3 | 33.33 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Thermodesulfobiota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Thermomicrobiota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Armatimonadota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 50.00 | 0.00 |
| Chrysiogenota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Dictyoglomota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Fibrobacterota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Kiritimatiellota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Ca. Fervidibacterota | 1 | 100.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 |
| Ca. Cloacimonadota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Ca. Bipolaricaulota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 |
| Ca. Absconditibacteriota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 |
| Calditrichota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Caldisericota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Ca. Omnitrophota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Coprothermobacterota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Vulcanimicrobiota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Thermosulfidibacterota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Nitrospinota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Minisyncoccota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Lentisphaerota | 1 | 100.00 | 0.00 | 100.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Fidelibacterota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 100.00 | 0.00 |
| Phylum | Number of genomes |
Full gene | V1–V2 | V1–V3 | V3–V4 | V3–V5 | V4 | V4–V5 | V4–V6 | V5–V6 | V5–V7 | V6–V7 | V6–V8 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 27F– 1492R (%) |
27F– 338R (%) |
27F– 534R (%) |
341F– 785R (%) |
341F– 944R (%) |
515F– 806R (%) |
515F– 944R (%) |
515F– 1100R (%) |
784F– 1100R (%) |
784F– 1193R (%) |
939F– 1193R (%) |
939F– 1378R (%) |
||
| Methanobacteriota | 459 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 82.14 | 0.00 | 0.00 | 0.00 | 0.00 |
| Thermoproteota | 110 | 0.91 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 89.09 | 0.00 | 0.00 | 0.00 | 0.00 |
| Nitrososphaerota | 31 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Thermoplasmatota | 19 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Ca. Nanohalarchaeota | 4 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Ca. Micrarchaeota | 2 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Nanobdellota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Promethearchaeota | 1 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 100.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 | 0.00 |
| Primer name | Sequence | Reference |
|---|---|---|
| 27F | AGAGTTTGATYMTGGCTCAG | Frank et al., 2008 |
| 338R | GCTGCCTCCCGTAGGAGT | Suzuki et al., 1996 |
| 341F * | CCTACGGGNGGCWGCAG | Klindworth et al., 2013 |
| 515F | GTGCCAGCMGCCGCGGTAA | Turner et al., 1999 |
| 534R | ATTACCGCGGCTGCTGG | Walker et al., 2015 |
| 784F | AGGATTAGATACCCTGGTA | Andersson et al., 2008 |
| 785R * | GACTACHVGGGTATCTAATCC | Klindworth et al., 2013 |
| 806R | GGACTACHVGGGTWTCTAAT | Caporaso et al., 2010 |
| 939F | GAATTGACGGGGGCCCGCACAAG | Lebuhn et al., 2014 |
| 944R | GAATTAAACCACATGCTC | Fuks et al., 2018 |
| 1100R | AGGGTTGCGCTCGTTG | Turner et al., 1999 |
| 1193R | ACGTCATCCCCACCTTCC | Bodenhausen et al, 2013 |
| 1378R | CGGTGTGTACAAGGCCCGGGAACG | Lebuhn et al., 2014 |
| 1492R | TACCTTGTTACGACTT | Frank et al., 2008 |
| SSU1ArF | TCCGGTTGATCCYGCBRG | Bahram et al., 2018 |
| SSU520R | GCTACGRRYGYTTTARRC | Bahram et al., 2018 |
| 340f | CCCTAYGGGGYGCASCAG | Gantner et al., 2011 |
| 806rB | GGACTACNVGGGTWTCTAAT | Appril et al., 2015 |
| 349f | GYGCASCAGKCGMGAAW | Takai and Horikoshi, 2000 |
| 519r | TTACCGCGGCKGCTG | Klindworth et al., 2013 |
| 515fB | GTGYCAGCMGCCGCGGTAA | Parada et al., 2015 |
| Parch519f | CAGCCGCCGCGGTAA | Ovreås et al., 1997 |
| Arch915r | GTGCTCCCCCGCCAATTCCT | Raskin et al., 1994 |
| 1106F | TTWAGTCAGGCAACGAGC | Watanabe et al., 2007 |
| Ar1378R ** | TGTGCAAGGAGCAGGGAC | Watanabe et al., 2007 |
| A751F | CCGACGGTGAGRGRYGAA | Baker et al., 2003 |
| SSU1492Rngs | CGGNTACCTTGTKACGAC | Bahram et al., 2018 |
| SSU280ArR | TCAGWNYCCNWCTCSRGG | Bahram et al., 2018 |
| SSU470R | DCNGCNGGTDTTACCGCG | Bahram et al., 2018 |
| SSU468R | GNDCNGCNGGTDTTACCG | Bahram et al., 2018 |
| A519R | GGTDTTACCGCGGCKGCTG | Wang and Qian, 2009 |
| SSU666ArR | HGCYTTCGCCACHGGTRG | Bahram et al., 2018 |
| SSU1000ArR | GGCCATGCAMYWCCTCTC | Bahram et al., 2018 |
| UA1204R | TTMGGGGCATRCIKACCT | Baker et al., 2003 |
* Primers 341F and 785R are used in the protocol for library preparation for sequencing of V3–V4 region of 16S rRNA genes on Illumina MiSeq.
** Ar1378R is originally named 1378R. We use amended name to avoid confusion.
RiboGrove, 2025-09-28