The main website where RiboGrove is hosted may be unavailable outside Belarus due to technical troubles and the overall disaster.
Hence this mirror has been created, and RiboGrove files are available through Zenodo (links are below).




Contents


Downloads

RiboGrove release 22.228 (2025-01-14)

The release is based on RefSeq release 228.

The fasta file is compressed with gzip, and the metadata file is a zip archive. To uncompress them, Linux and Mac OS users may use gzip and zip programs, they should be built-in. For Windows users, the free and open-source (de)compression program 7-Zip is available.

RiboGrove release archive

You can find all releases in the RiboGrove release archive.

Release notes

Starting with RiboGrove 22.228,

  1. We publish coverage values for PCR primers pairs commonly used to amplify V-regions of archaeal 16S rRNA genes. See the section “Coverage of primer pairs...” below.
  2. Metadata does not contain tables gene_seqs_statistics.tsv and discarded_gene_seqs_statistics.tsv, because they contain much redundant data: taxonomy and genome categories. This data is in the separate tables: taxonomy.tsv and categories.tsv. In place of the removed files, metadata now contains files gene_seqs_base_counts.tsv and discarded_gene_seqs_base_counts.tsv. One can still make a gene_seqs_statistics.tsv table using the script merge_bases_categories_taxonomy.py from ribogrove-tools.

You can find notes to all RiboGrove releases on the release notes page.


Statistical summary

RiboGrove size
BacteriaArchaeaTotal
Number of gene sequences 252,975 1,047 254,189
Number of unique gene sequences 61,446 740 62,270
Number of species 11,598 479 12,114
Number of genomes 45,900 602 46,539
Number of genomes of category 1 30,883 243 31,152
Number of genomes of category 2 14,784 359 15,154
Number of genomes of category 3 233 0 233
16S rRNA gene lengths
BacteriaArchaea
Minimum (bp) 1,401.00 1,439.00
25th percentile (bp) * 1,517.00 1,471.00
Median (bp) * 1,529.00 1,473.00
75th percentile (bp) * 1,542.00 1,483.00
Average (bp) * 1,527.22 1,491.71
Mode (bp) * 1,537.00 1,472.00
Maximum (bp) 2,438.00 3,604.00
Standard deviation (bp) * 25.12 123.15

* Metrics marked with an asterisk were calculated with preliminary normalization, i.e. median within-species gene length was used for the summary.

16S rRNA gene copy number
Copy number *BacteriaArchaea
Number of speciesPercent of species (%)Number of speciesPercent of species (%)
1 1,450 12.50 243 50.73
2 1,934 16.68 139 29.02
3 1,614 13.92 72 15.03
4 1,395 12.03 19 3.97
5 869 7.49 6 1.25
6 1,533 13.22 0 0.00
7 1,076 9.28 0 0.00
8 621 5.35 0 0.00
9 317 2.73 0 0.00
10 306 2.64 0 0.00
11 148 1.28 0 0.00
12 131 1.13 0 0.00
13 54 0.47 0 0.00
14 83 0.72 0 0.00
15 24 0.21 0 0.00
16 9 0.08 0 0.00
17 11 0.09 0 0.00
18 7 0.06 0 0.00
19 2 0.02 0 0.00
20 8 0.07 0 0.00
21 1 0.01 0 0.00
22 1 0.01 0 0.00
24 1 0.01 0 0.00
25 1 0.01 0 0.00
27 1 0.01 0 0.00
37 1 0.01 0 0.00

* These are median within-species copy numbers.

Top-10 longest 16S rRNA genes
OrganismGene length (bp)RiboGrove Sequence ID(s)Assembly
accession
Bacteria
Thermus thermophilus strain AA2-2 2,438 GCF_019974355.1:NZ_AP024929.1:249100-251537:minus GCF_019974355.1
Ca. Annandia pinicola strain Ad13-065 1,887 GCF_020541245.1:NZ_CP045876.1:290071-291957:minus GCF_020541245.1
Thermoanaerobacter ethanolicus strain JW 200 1,812 GCF_003722315.1:NZ_CP033580.1:456062-457873:plus GCF_003722315.1
Nitrosophilus labii strain HRV44 1,806 GCF_014466985.1:NZ_AP022826.1:1258017-1259822:minus
GCF_014466985.1:NZ_AP022826.1:1532588-1534393:minus
GCF_014466985.1:NZ_AP022826.1:1939914-1941719:minus
GCF_014466985.1
Sporomusa rhizae strain DSM 16652 1,802 GCF_041428845.1:NZ_CP156925.1:3123180-3124981:minus GCF_041428845.1
Gelria sp. Kuro-4 1,788 GCF_019668485.1:NZ_AP024619.1:2016182-2017969:minus GCF_019668485.1
Helicobacter mastomyrinus strain Hm-17 1,785 GCF_039555295.1:NZ_CP145316.1:765140-766924:minus GCF_039555295.1
Thermoanaerobacter pseudethanolicus strain ATCC 33223 1,781 GCF_000019085.1:NC_010321.1:2265744-2267524:minus GCF_000019085.1
Thermoanaerobacter brockii strain Ako-1 1,781 GCF_000175295.2:NC_014964.1:2252888-2254668:minus GCF_000175295.2
Thermoanaerobacter sp. RKWS2 1,754 GCF_026240795.1:NZ_CP110888.1:94012-95765:plus GCF_026240795.1
Archaea
Pyrobaculum ferrireducens strain 1860 3,604 GCF_000234805.1:NC_016645.1:127214-130817:plus GCF_000234805.1
Pyrobaculum aerophilum strain IM2 2,213 GCF_000007225.1:NC_003364.1:1089640-1091852:plus GCF_000007225.1
Pyrobaculum arsenaticum strain DSM 13514 2,212 GCF_000016385.1:NC_009376.1:623323-625534:minus GCF_000016385.1
Aeropyrum pernix strain K1 2,202 GCF_000011125.1:NC_000854.2:1218712-1220913:minus GCF_000011125.1
Pyrobaculum neutrophilum strain V24Sta 2,197 GCF_000019805.1:NC_010525.1:690419-692615:plus GCF_000019805.1
Ca. Mancarchaeum acidiphilum strain Mia14 2,008 GCF_002214165.1:NZ_CP019964.1:751297-753304:minus GCF_002214165.1
Ca. Micrarchaeum sp. A_DKE 2,003 GCF_016806735.1:NZ_CP060530.1:203642-205644:minus GCF_016806735.1
Caldivirga maquilingensis strain IC-167 1,679 GCF_000018305.1:NC_009954.1:129150-130828:minus GCF_000018305.1
Aeropyrum camini strain SY1 1,650 GCF_000591035.1:NC_022521.1:1165168-1166817:minus GCF_000591035.1
Pyrolobus fumarii strain 1A 1,576 GCF_000223395.1:NC_015931.1:84671-86246:minus GCF_000223395.1
Top-10 shortest 16S rRNA genes
OrganismGene length (bp)RiboGrove Sequence ID(s)Assembly
accession
Bacteria
Anabaena sp. YBS01 1,401 GCF_009498015.1:NZ_CP034058.1:6920299-6921699:minus GCF_009498015.1
Clostridioides difficile strain TW11 1,426 GCF_009362915.1:NZ_CP045224.1:4068440-4069865:minus GCF_009362915.1
Staphylococcus warneri strain TWSL_1 1,440 GCF_032147125.1:NZ_CP135051.1:2625669-2627108:plus GCF_032147125.1
Roseicitreum antarcticum strain ZS2-28 1,447 GCF_014681765.1:NZ_CP061498.1:3436150-3437596:plus GCF_014681765.1
Hirschia baltica strain ATCC 49814 1,448 GCF_000023785.1:NC_012982.1:2336679-2338126:minus GCF_000023785.1
Sagittula stellata strain E-37 1,449 GCF_039724765.1:NZ_CP155729.1:664616-666064:plus
GCF_039724765.1:NZ_CP155729.1:1804792-1806240:plus
GCF_039724765.1
Sagittula sp. MA-2 1,449 GCF_030126985.1:NZ_CP126145.1:439-1887:plus
GCF_030126985.1:NZ_CP126145.1:2907211-2908659:minus
GCF_030126985.1
Mameliella alba strain KU6B 1,449 GCF_011405015.1:NZ_AP022337.1:1420943-1422391:plus
GCF_011405015.1:NZ_AP022337.1:3191212-3192660:minus
GCF_011405015.1:NZ_AP022337.1:267140-268588:plus
GCF_011405015.1
Sagittula sp. P11 1,449 GCF_002814095.1:NZ_CP021913.1:3597920-3599368:plus
GCF_002814095.1:NZ_CP021913.1:2386837-2388285:plus
GCF_002814095.1
Clostridioides difficile strain Cd18 1,450 GCF_018884705.1:NZ_CP037806.1:136016-137465:plus GCF_018884705.1
Archaea
Ignicoccus hospitalis strain KIN4/I 1,439 GCF_000017945.1:NC_009776.1:728362-729800:plus GCF_000017945.1
Methanocaldococcus lauensis strain SG7 1,457 GCF_902827225.1:NZ_LR792632.1:542755-544211:plus GCF_902827225.1
Halorubrum sp. BOL3-1 1,463 GCF_004114375.1:NZ_CP034692.1:397753-399215:minus GCF_004114375.1
Methanomethylophilus alvi strain MGYG-HGUT-02456 1,466 GCF_902387285.1:NZ_LR699000.1:283607-285072:plus GCF_902387285.1
Natronomonas gomsonensis strain KCTC 4088 1,466 GCF_024300825.1:NZ_CP101323.1:2500564-2502029:plus GCF_024300825.1
Ca. Methanomethylophilus alvi strain Mx1201 1,466 GCF_000300255.2:NC_020913.1:283607-285072:plus GCF_000300255.2
Salinirubellus sp. SYNS196 1,466 GCF_037335815.1:NZ_CP147841.1:597195-598660:minus GCF_037335815.1
Salinirubellus salinus strain ZS-35-S2 1,466 GCF_025231485.1:NZ_CP104003.1:3070232-3071697:plus GCF_025231485.1
Methanospirillum sp. J.3.6.1-F.2.7.3 1,466 GCF_018502485.1:NZ_CP075546.1:133354-134819:plus
GCF_018502485.1:NZ_CP075546.1:825954-827419:plus
GCF_018502485.1:NZ_CP075546.1:872641-874106:plus
GCF_018502485.1:NZ_CP075546.1:1727419-1728884:plus
GCF_018502485.1
Methanospirillum hungatei strain JF-1 1,466 GCF_000013445.1:NC_007796.1:39814-41279:plus
GCF_000013445.1:NC_007796.1:1301079-1302544:minus
GCF_000013445.1:NC_007796.1:3501525-3502990:minus
GCF_000013445.1:NC_007796.1:3507609-3509074:minus
GCF_000013445.1
Methanospirillum stamsii strain Pt1 1,466 GCF_046244385.1:NZ_CP176366.1:1311724-1313189:plus
GCF_046244385.1:NZ_CP176366.1:2035802-2037267:plus
GCF_046244385.1:NZ_CP176366.1:2042927-2044392:plus
GCF_046244385.1:NZ_CP176366.1:3625347-3626812:minus
GCF_046244385.1
Methanomethylophilus alvi strain Mx-05 1,466 GCF_003711245.1:NZ_CP017686.1:283608-285073:plus GCF_003711245.1
Methanospirillum hungatei strain GP1 1,466 GCF_019263745.1:NZ_CP077107.1:4649-6114:plus
GCF_019263745.1:NZ_CP077107.1:1359562-1361027:minus
GCF_019263745.1:NZ_CP077107.1:1365502-1366967:minus
GCF_019263745.1:NZ_CP077107.1:1986020-1987485:minus
GCF_019263745.1
Natronomonas halophila strain C90 1,466 GCF_013391085.1:NZ_CP058334.1:1530622-1532087:minus GCF_013391085.1
Natronomonas marina strain ZY43 1,466 GCF_024298905.1:NZ_CP101154.1:18680-20145:plus GCF_024298905.1
Top-10 genomes with the largest 16S rRNA copy numbers
OrganismCopy numberAssembly
accession
Bacteria
Tumebacillus avium strain AR23208 37 GCF_002162355.1
Tumebacillus algifaecis strain THMBR28 27 GCF_002243515.1
Photobacterium piscicola strain WVL24019 25 GCF_046058925.1
Photobacterium phosphoreum strain MIP2473 24 GCF_949787665.1
Mesobacillus maritimus strain ADH-29 22 GCF_044803185.1
Peribacillus asahii strain KF4 21 GCF_023823975.1
Photobacterium damselae strain Phdp Wu-1 21 GCF_003130755.1
Aneurinibacillus sp. Ricciae_BoGa-3 21 GCF_028421645.1
Photobacterium damselae strain Pdd1411 21 GCF_030168855.1
Neobacillus drentensis strain JC05 20 GCF_021560175.1
Photobacterium damselae strain AS-15-3942-7 20 GCF_021768405.1
Photobacterium damselae strain AS-15-0759-2 20 GCF_021768425.1
Photobacterium damselae strain CSP DAM2 20 GCF_021765875.1
Photobacterium toruni strain WD2103 20 GCF_024494545.1
Moritella sp. 5 20 GCF_018219455.1
Moritella sp. 36 20 GCF_018219415.1
Domibacillus sp. DTU_2020_1001157_1_SI_ALB_TIR_016 20 GCF_032341995.1
Photobacterium damselae strain CSP DAM1 20 GCF_021766015.1
Photobacterium damselae strain AS-15-3942-9 20 GCF_021768365.1
Photobacterium damselae strain XP-11 20 GCF_023973125.1
Clostridium tagluense strain CM008 20 GCF_030585445.1
Neobacillus sp. SuZ13 20 GCF_030123365.1
Photobacterium damselae strain AS-16-0963-1 20 GCF_021768345.1
Moritella sp. 28 20 GCF_018219435.1
Peribacillus sp. SCS-155 20 GCF_046237635.1
Photobacterium damselae strain RM-71 20 GCF_001708035.2
Photobacterium damselae strain 9046-81 20 GCF_009763125.1
Photobacterium damselae strain 04Ya311 20 GCF_026001825.1
Photobacterium damselae strain WMD-P2 20 GCF_038086725.1
Photobacterium damselae strain WMD-P3 20 GCF_038086915.1
Photobacterium damselae strain WMD-P1 20 GCF_038086615.1
Archaea
Natronorubrum aibiense strain 7-3 5 GCF_009392895.1
Natronorubrum bangense strain JCM 10635 5 GCF_004799645.1
Methanoplanus endosymbiosus strain DSM 3599 5 GCF_024662215.1
Natrinema sp. SYSU A 869 5 GCF_019879105.1
Methanolobus sp. ZRKC3 5 GCF_045291275.1
Methanococcoides orientis strain LMO-1 5 GCF_021184045.1
Methanolobus sediminis strain FTZ6 4 GCF_031312595.1
Methanogenium organophilum strain DSM 3596 4 GCF_026684035.1
Methanochimaera problematica strain FWC-SCC4 4 GCF_032878975.1
Methanococcus vannielii strain SB 4 GCF_000017165.1
Uncultured Methanospirillum sp. 4 GCF_963668475.1
Methanosphaera stadtmanae strain MGYG-HGUT-02164 4 GCF_902384015.1
Methanolobus sp. WCC4 4 GCF_038022665.1
Methanospirillum lacunae strain Ki8-1 4 GCF_046195335.1
Methanospirillum stamsii strain Pt1 4 GCF_046244385.1
Methanogenium sp. S4BF 4 GCF_029633965.1
Natrinema thermotolerans strain A29 4 GCF_031165565.1
Methanolobus mangrovi strain FTZ2 4 GCF_031312535.1
Halomicrobium salinisoli strain TH30 4 GCF_020405245.1
Halomicrobium salinisoli strain LT50 4 GCF_020405185.1
Methanospirillum hungatei strain GP1 4 GCF_019263745.1
Halomicrobium urmianum strain IBRC-M: 10911 4 GCF_020217425.1
Methanospirillum sp. J.3.6.1-F.2.7.3 4 GCF_018502485.1
Natronococcus occultus strain SP4 4 GCF_000328685.1
Methanospirillum hungatei strain JF-1 4 GCF_000013445.1
Methanosphaera stadtmanae strain DSM 3091 4 GCF_000012545.1
Haloarcula sinaiiensis strain ATCC 33800 4 GCF_018200015.1
Haloterrigena salifodinae strain BOL5-1 4 GCF_016906025.1
Top-10 genomes with the highest intragenomic variability of 16S rRNA genes
OrganismSum of entropy * (bits)Mean entropy * (bits)Number of variable positionsGene copy numberAssembly
accession
Bacteria
Escherichia coli strain P276M 433.81 0.26 569 6 GCF_009762385.1
Listeria monocytogenes strain 10-092876-1155 LM6 357.10 0.20 370 3 GCF_001999045.1
Klebsiella pneumoniae strain GZ-1 304.27 0.18 464 8 GCF_014854815.1
Streptococcus infantis strain SO 291.50 0.18 308 3 GCF_021497965.1
Synechococcus sp. NB0720_010 243.35 0.16 265 3 GCF_023078835.1
Streptomyces griseorubiginosus strain NBC_00586 231.55 0.15 342 6 GCF_036345135.1
Caminibacter mediatlanticus strain TB-2 228.78 0.15 282 4 GCF_005843985.1
Xanthomonas oryzae strain YNCX 227.74 0.15 248 3 GCF_024499285.1
Sporomusa termitida strain DSM 4440 226.25 0.13 247 12 GCF_007641255.1
Campylobacter hyointestinalis strain CHY5 217.64 0.13 237 3 GCF_013372165.1
Archaea
Halomicrobium sp. ZPS1 ** 137.00 0.09 137 2 GCF_009217585.1
Halomicrobium urmianum strain IBRC-M: 10911 131.55 0.09 146 4 GCF_020217425.1
Halapricum desulfuricans strain HSR12-2 128.00 0.09 128 2 GCF_017094525.1
Halomicrobium salinisoli strain TH30 127.74 0.09 145 4 GCF_020405245.1
Halapricum desulfuricans strain HSR-Bgl 127.00 0.09 127 2 GCF_017094445.1
Halomicrobium mukohataei strain JP60 125.81 0.09 137 3 GCF_004803735.1
Halomicrobium sp. HM KBTZ05 124.38 0.08 134 3 GCF_041530035.1
Halomicrobium salinisoli strain LT50 123.31 0.08 140 4 GCF_020405185.1
Halapricum desulfuricans strain HSR-Est 111.00 0.08 111 2 GCF_017094465.1
Halapricum desulfuricans strain HSR12-1 109.00 0.07 109 2 GCF_017094505.1

* Entropy is Shannon entropy calculated for each column of the multiple sequence alignment (MSA) of all full-length 16S rRNA genes of a genome. Entropy is then summed up (column “Sum of entropy”) and averaged (column “Mean entropy”).

** Halomicrobium sp. ZPS1 is a quite remarkable case. This genome harbours two 16S rRNA genes, therefore entropy is equal to the number of mismatching nucleotides between sequences of the genes. Respectively, percent of identity between these two gene sequences is 90.70%! This is remarkable because the usual (however arbitrary) genus demarcation threshold of percent of identity is 95%.

Coverage* of primer pairs for different V-regions of 16S rRNA genes

* Coverage of a primer pair is the percent of genomes having at least one 16S rRNA gene which can be amplified by PCR using this primer pair. For details, see our paper about RiboGrove.

In the tables below, you can find coverage of primer pairs that are being commonly used to amplify bacterial and archaeal genes (“bacterial” and “archaeal” primers).

You can find a more detailed table in the file primer_pair_genomic_coverage.tsv in the metadata. That table contains coverage not just for phyla, but also for each class, order, family, genus, and species. Moreover, that table contains coverage values for primer pair 1115F–1492R (V7–V9 region). In the tables below, it is omitted for brevity.

Bacterial genes, “bacterial” primers
Phylum Number
of genomes
Full gene V1–V2 V1–V3 V3–V4 V3–V5 V4 V4–V5 V4–V6 V5–V6 V5–V7 V6–V7 V6–V8
27F–1492R
(%)
27F–338R
(%)
27F–534R
(%)
341F–785R
(%)
341F–944R
(%)
515F–806R
(%)
515F–944R
(%)
515F–1100R
(%)
784F–1100R
(%)
784F–1193R
(%)
939F–1193R
(%)
939F–1378R
(%)
Pseudomonadota 25,114 99.70 99.49 99.68 99.93 83.91 99.89 83.99 88.98 88.72 93.41 92.42 96.38
Bacillota 10,533 99.82 99.73 99.77 99.91 95.27 99.97 95.15 99.47 98.13 97.57 98.67 99.44
Actinomycetota 4,736 99.89 99.20 99.70 94.68 68.03 94.53 67.86 96.88 99.75 99.83 99.83 96.81
Bacteroidota 1,569 96.24 95.86 96.30 99.94 63.93 99.36 63.48 38.50 38.62 94.01 92.48 95.28
Campylobacterota 1,239 100.00 100.00 100.00 100.00 100.00 99.92 99.92 99.92 99.60 99.60 99.68 99.52
Mycoplasmatota 736 89.81 83.70 71.47 98.51 90.62 98.64 91.03 74.46 48.10 42.39 75.54 0.54
Spirochaetota 449 47.44 47.88 47.88 94.43 99.78 94.43 99.78 99.78 78.40 78.40 91.31 37.86
Cyanobacteriota 293 99.66 99.66 99.66 100.00 4.44 100.00 4.44 100.00 1.37 1.37 100.00 99.66
Fusobacteriota 224 100.00 98.66 99.55 99.55 99.55 99.55 99.55 99.55 99.55 99.55 100.00 0.00
Chlamydiota 211 0.00 0.00 0.00 100.00 100.00 0.00 0.00 0.00 100.00 100.00 100.00 93.84
Verrucomicrobiota 139 99.28 0.00 99.28 100.00 12.23 100.00 12.23 100.00 1.44 1.44 98.56 98.56
Thermodesulfobacteriota 137 100.00 99.27 100.00 100.00 43.80 100.00 43.80 100.00 94.16 89.78 94.89 98.54
Deinococcota 92 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 54.35 100.00
Myxococcota 65 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Planctomycetota 63 100.00 19.05 100.00 100.00 63.49 100.00 63.49 0.00 0.00 0.00 3.17 0.00
Chloroflexota 50 100.00 92.00 100.00 44.00 0.00 94.00 0.00 90.00 12.00 12.00 94.00 28.00
Thermotogota 42 100.00 97.62 100.00 100.00 9.52 100.00 9.52 100.00 0.00 0.00 59.52 97.62
Acidobacteriota 41 97.56 97.56 97.56 100.00 100.00 100.00 100.00 100.00 70.73 58.54 87.80 100.00
Bdellovibrionota 34 100.00 100.00 100.00 100.00 70.59 100.00 70.59 100.00 100.00 100.00 100.00 100.00
Aquificota 17 100.00 11.76 100.00 100.00 11.76 100.00 11.76 100.00 0.00 0.00 0.00 11.76
Chlorobiota 15 100.00 100.00 100.00 100.00 0.00 0.00 0.00 0.00 100.00 93.33 86.67 6.67
Nitrospirota 15 100.00 100.00 100.00 100.00 73.33 100.00 73.33 100.00 100.00 73.33 73.33 100.00
Rhodothermota 13 30.77 30.77 30.77 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Ca. Saccharibacteria 12 100.00 100.00 100.00 100.00 8.33 8.33 8.33 8.33 0.00 0.00 100.00 100.00
Synergistota 9 100.00 100.00 100.00 100.00 0.00 100.00 0.00 100.00 0.00 0.00 100.00 100.00
Gemmatimonadota 7 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Deferribacterota 6 100.00 100.00 100.00 100.00 0.00 100.00 0.00 100.00 100.00 100.00 100.00 100.00
Elusimicrobiota 4 100.00 50.00 100.00 100.00 0.00 100.00 0.00 100.00 75.00 75.00 100.00 100.00
Ignavibacteriota 3 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Armatimonadota 2 100.00 50.00 100.00 50.00 50.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Kiritimatiellota 2 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00 100.00
Thermodesulfobiota 2 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00
Thermomicrobiota 2 100.00 100.00 100.00 100.00 0.00 100.00 0.00 100.00 0.00 0.00 50.00 50.00
Atribacterota 2 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00 100.00
Balneolota 2 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Chrysiogenota 2 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Dictyoglomota 2 100.00 100.00 100.00 100.00 0.00 100.00 0.00 100.00 0.00 0.00 100.00 0.00
Fibrobacterota 2 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Ca. Cloacimonadota 1 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Ca. Absconditibacteriota 1 100.00 0.00 100.00 100.00 0.00 100.00 0.00 0.00 0.00 100.00 0.00 0.00
Calditrichota 1 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00
Caldisericota 1 100.00 100.00 100.00 100.00 0.00 0.00 0.00 0.00 0.00 100.00 100.00 100.00
Ca. Bipolaricaulota 1 0.00 0.00 0.00 100.00 100.00 100.00 100.00 0.00 0.00 0.00 0.00 0.00
Ca. Fervidibacterota 1 100.00 0.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00 100.00
Ca. Omnitrophota 1 100.00 100.00 100.00 100.00 0.00 100.00 0.00 100.00 100.00 100.00 100.00 100.00
Vulcanimicrobiota 1 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00 100.00
Thermosulfidibacterota 1 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00 100.00
Nitrospinota 1 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00 100.00
Lentisphaerota 1 100.00 0.00 100.00 100.00 100.00 100.00 100.00 100.00 0.00 0.00 100.00 100.00
Fidelibacterota 1 100.00 100.00 100.00 100.00 0.00 100.00 0.00 100.00 100.00 100.00 100.00 100.00
Coprothermobacterota 1 0.00 0.00 0.00 100.00 100.00 100.00 100.00 0.00 0.00 0.00 100.00 0.00
Archaeal genes, “archaeal” primers
Phylum Number
of genomes
V1–V4 V3–V4 V3 V4 V4–V5 V7–V8
SSU1ArF–SSU520R
(%)
340f–806rB
(%)
349f–519r
(%)
515fB–806rB
(%)
Parch519f–Arch915r
(%)
1106F–Ar1378R
(%)
Methanobacteriota 439 88.84 100.00 99.09 100.00 99.54 83.60
Thermoproteota 107 99.07 100.00 74.77 100.00 99.07 89.72
Nitrososphaerota 30 96.67 100.00 100.00 100.00 100.00 0.00
Thermoplasmatota 19 100.00 100.00 78.95 100.00 100.00 0.00
Ca. Nanohalarchaeota 3 100.00 100.00 33.33 100.00 100.00 0.00
Ca. Micrarchaeota 2 0.00 0.00 0.00 0.00 0.00 0.00
Nanobdellota 1 100.00 0.00 0.00 0.00 0.00 0.00
Promethearchaeota 1 100.00 100.00 100.00 100.00 100.00 0.00

Bacterial genes, “archaeal” primers
Bacterial genes, “archaeal” primers
Phylum Number
of genomes
V1–V4 V3–V4 V3 V4 V4–V5 V7–V8
SSU1ArF–SSU520R
(%)
340f–806rB
(%)
349f–519r
(%)
515fB–806rB
(%)
Parch519f–Arch915r
(%)
1106F–Ar1378R
(%)
Pseudomonadota 25,114 0.04 0.09 0.18 99.89 28.18 0.00
Bacillota 10,533 0.01 0.07 11.91 99.97 98.40 0.00
Actinomycetota 4,736 0.17 0.04 0.00 94.53 88.58 0.00
Bacteroidota 1,569 0.00 0.19 0.13 99.36 99.24 0.00
Campylobacterota 1,239 0.00 0.00 0.00 99.92 0.16 0.00
Mycoplasmatota 736 0.00 0.00 0.00 98.64 77.45 0.00
Spirochaetota 449 0.00 0.00 0.00 94.43 94.21 0.00
Cyanobacteriota 293 0.00 0.00 0.00 100.00 100.00 0.00
Fusobacteriota 224 0.00 0.00 0.00 99.55 99.55 0.00
Chlamydiota 211 0.00 0.00 0.00 0.00 0.00 0.00
Verrucomicrobiota 139 0.00 0.00 90.65 100.00 9.35 0.00
Thermodesulfobacteriota 137 0.00 0.00 0.00 100.00 75.18 0.00
Deinococcota 92 0.00 0.00 0.00 100.00 97.83 0.00
Myxococcota 65 0.00 0.00 1.54 100.00 100.00 0.00
Planctomycetota 63 0.00 0.00 71.43 100.00 79.37 0.00
Chloroflexota 50 0.00 0.00 0.00 94.00 100.00 0.00
Thermotogota 42 0.00 2.38 0.00 100.00 100.00 0.00
Acidobacteriota 41 0.00 0.00 12.20 100.00 100.00 0.00
Bdellovibrionota 34 0.00 0.00 0.00 100.00 35.29 0.00
Aquificota 17 0.00 0.00 0.00 100.00 88.24 0.00
Chlorobiota 15 0.00 0.00 0.00 0.00 0.00 0.00
Nitrospirota 15 0.00 0.00 0.00 100.00 100.00 0.00
Rhodothermota 13 0.00 0.00 0.00 100.00 100.00 0.00
Ca. Saccharibacteria 12 0.00 0.00 0.00 8.33 8.33 0.00
Synergistota 9 0.00 0.00 0.00 100.00 100.00 0.00
Gemmatimonadota 7 0.00 0.00 0.00 100.00 100.00 0.00
Deferribacterota 6 0.00 0.00 0.00 100.00 100.00 0.00
Elusimicrobiota 4 0.00 0.00 0.00 100.00 100.00 0.00
Ignavibacteriota 3 0.00 0.00 0.00 100.00 100.00 0.00
Armatimonadota 2 0.00 0.00 0.00 100.00 50.00 0.00
Kiritimatiellota 2 0.00 0.00 100.00 100.00 100.00 0.00
Thermodesulfobiota 2 0.00 0.00 0.00 100.00 100.00 0.00
Thermomicrobiota 2 0.00 0.00 0.00 100.00 100.00 0.00
Atribacterota 2 0.00 0.00 0.00 100.00 100.00 0.00
Balneolota 2 0.00 0.00 0.00 100.00 100.00 0.00
Chrysiogenota 2 0.00 0.00 0.00 100.00 100.00 0.00
Dictyoglomota 2 0.00 0.00 0.00 100.00 100.00 0.00
Fibrobacterota 2 0.00 0.00 0.00 100.00 100.00 0.00
Ca. Cloacimonadota 1 0.00 0.00 100.00 100.00 100.00 0.00
Ca. Absconditibacteriota 1 0.00 0.00 0.00 100.00 0.00 0.00
Calditrichota 1 0.00 0.00 0.00 100.00 100.00 0.00
Caldisericota 1 0.00 0.00 0.00 0.00 0.00 0.00
Ca. Bipolaricaulota 1 0.00 0.00 0.00 100.00 0.00 0.00
Ca. Fervidibacterota 1 0.00 0.00 0.00 100.00 0.00 0.00
Ca. Omnitrophota 1 0.00 0.00 100.00 100.00 100.00 0.00
Vulcanimicrobiota 1 0.00 0.00 0.00 100.00 100.00 0.00
Thermosulfidibacterota 1 0.00 0.00 0.00 100.00 100.00 0.00
Nitrospinota 1 0.00 0.00 0.00 100.00 100.00 0.00
Lentisphaerota 1 0.00 0.00 100.00 100.00 100.00 0.00
Fidelibacterota 1 0.00 0.00 0.00 100.00 100.00 0.00
Coprothermobacterota 1 0.00 0.00 0.00 100.00 100.00 0.00

Archaeal genes, “bacterial” primers
Archaeal genes, “bacterial” primers
Phylum Number
of genomes
Full gene V1–V2 V1–V3 V3–V4 V3–V5 V4 V4–V5 V4–V6 V5–V6 V5–V7 V6–V7 V6–V8
27F–1492R
(%)
27F–338R
(%)
27F–534R
(%)
341F–785R
(%)
341F–944R
(%)
515F–806R
(%)
515F–944R
(%)
515F–1100R
(%)
784F–1100R
(%)
784F–1193R
(%)
939F–1193R
(%)
939F–1378R
(%)
Methanobacteriota 439 0.23 0.23 0.23 0.23 0.00 100.00 0.00 82.23 0.23 0.23 0.23 0.23
Thermoproteota 107 0.93 0.00 0.00 0.00 0.00 100.00 0.00 88.79 0.00 0.00 0.00 0.00
Nitrososphaerota 30 0.00 0.00 0.00 0.00 0.00 100.00 0.00 0.00 0.00 0.00 0.00 0.00
Thermoplasmatota 19 0.00 0.00 0.00 0.00 0.00 100.00 0.00 0.00 0.00 0.00 0.00 0.00
Ca. Nanohalarchaeota 3 0.00 0.00 0.00 0.00 0.00 100.00 0.00 0.00 0.00 0.00 0.00 0.00
Ca. Micrarchaeota 2 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
Nanobdellota 1 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00
Promethearchaeota 1 0.00 0.00 0.00 0.00 0.00 100.00 0.00 0.00 0.00 0.00 0.00 0.00

Primers used for coverage estimation
Primers used for coverage estimation
Primer nameSequenceReference
27FAGAGTTTGATYMTGGCTCAGFrank et al., 2008
338RGCTGCCTCCCGTAGGAGTSuzuki et al., 1996
341F *CCTACGGGNGGCWGCAGKlindworth et al., 2013
515FGTGCCAGCMGCCGCGGTAATurner et al., 1999
534RATTACCGCGGCTGCTGGWalker et al., 2015
784FAGGATTAGATACCCTGGTAAndersson et al., 2008
785R *GACTACHVGGGTATCTAATCCKlindworth et al., 2013
806RGGACTACHVGGGTWTCTAATCaporaso et al., 2010
939FGAATTGACGGGGGCCCGCACAAGLebuhn et al., 2014
944RGAATTAAACCACATGCTCFuks et al., 2018
1100RAGGGTTGCGCTCGTTGTurner et al., 1999
1193RACGTCATCCCCACCTTCCBodenhausen et al, 2013
1378RCGGTGTGTACAAGGCCCGGGAACGLebuhn et al., 2014
1492RTACCTTGTTACGACTTFrank et al., 2008
SSU1ArFTCCGGTTGATCCYGCBRGFrancioli et al., 2021
SSU520RGCTACGRRYGYTTTARRCFrancioli et al., 2021
340fCCCTAYGGGGYGCASCAGFrancioli et al., 2021
806rBGGACTACNVGGGTWTCTAATFrancioli et al., 2021
349fGYGCASCAGKCGMGAAWFrancioli et al., 2021
519rTTACCGCGGCKGCTGFrancioli et al., 2021
515fBGTGYCAGCMGCCGCGGTAAFrancioli et al., 2021
Parch519fCAGCCGCCGCGGTAAFrancioli et al., 2021
Arch915rGTGCTCCCCCGCCAATTCCTFrancioli et al., 2021
1106FTTWAGTCAGGCAACGAGCFrancioli et al., 2021
Ar1378R **TGTGCAAGGAGCAGGGACFrancioli et al., 2021

* Primers 341F and 785R are used in the protocol for library preparation for sequencing of V3–V4 region of 16S rRNA genes on Illumina MiSeq.

** Ar1378R is originally named 1378R. We use amended name to avoid confusion.


RiboGrove, 2025-09-28